Quick Order

Text Size:AAA

Rat PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTNcDNA Clone Product Information
cDNA Size:507
cDNA Description:ORF Clone of Rattus norvegicus pleiotrophin DNA.
Gene Synonym:Hbnf
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Neurotrophin & Receptor Related Products

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.

  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items