After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ECSIT ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ECSIT cDNA Clone Product Information
Gene_bank_ref_id:BC000193
RefSeq ORF Size:1296bp
cDNA Description:Full length Clone DNA of Homo sapiens ECSIT homolog (Drosophila) with N terminal HA tag.
Gene Synonym:SITPEC
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ECSIT is an adapter protein of the toll-like and IL-1 receptor signaling pathway that is involved in the activation of NF-kappa-B via MAP3K1. Activation of NF-kappaB as a consequence of signaling through the Toll and IL-1 receptors is a major element of innate immune responses. ECSIT is specific for the Toll/IL-1 pathways and is a regulator of MEKK-1 processing. It bridges TRAF6 to MEKK-1. Expression of wild-type ECSIT accelerates processing of MEKK-1, whereas a dominant-negative fragment of ECSIT blocks MEKK-1 processing and activation of NF-kappaB. ECSIT is also required for normal embryonic development and efficient assembly of mitochondrial NADH:ubiquinone oxidoreductase.

References
  • Kopp E. et al., 1999, Genes Dev. 13 (16): 2059-71.
  • The MGC Project Team. 2004, Genome Res. 14: 2121-7.
  • Vogel RO. et al., 2007, Genes Dev. 21: 615-24.
  • Size / Price
    Catalog: HG14497-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"