Quick Order

Mouse FCER1A ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FCER1A cDNA Clone Product Information
Gene_bank_ref_id:NM_010184.2
RefSeq ORF Size:753bp
cDNA Description:Full length Clone DNA of Mus musculus Fc receptor, IgE, high affinity I, alpha polypeptide with C terminal His tag.
Gene Synonym:FcERI, Fce1a, Fcr-5, fcepsilonri, Fcer1a
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

FcERI, also known as FCER1A, is the alpha subunit of the immunoglobulin epsilon receptor (IgE receptor). IgE receptor is a high affinity IgE receptor which plays a central role in allergic disease, coupling allergen and mast cell to initiate the inflammatory and immediate hypersensitivity responses that are characteristic of disorders such as hay fever and asthma. The allergic response occurs when 2 or more IgE receptors are crosslinked via IgE molecules that in turn are bound to an allergen (antigen) molecule. A perturbation occurs that brings about the release of histamine and proteases from the granules in the cytoplasm of the mast cell and leads to the synthesis of prostaglandins and leukotrienes--potent effectors of the hypersensitivity response. IgE receptor is comprised of an alpha subunit(FcERI), a beta subunit, and two gamma subunits. FcERI is glycosylated and contains 2 Ig-like (immunoglobulin-like) domains.

References
  • Shikanai T, et al. (2002) Sequence variants in the FcepsilonRI alpha chain gene. J Appl Physiol. 93(1):37-41.
  • Sada K, et al. (2002) Regulation of FcepsilonRI-mediated degranulation by an adaptor protein 3BP2 in rat basophilic leukemia RBL-2H3 cells. Blood. 100(6):2138-44.
  • Takahashi K, et al. (2003) Transcriptional regulation of the human high affinity IgE receptor alpha-chain gene. Mol Immunol. 38(16-18):1193-9.
  • Size / Price
    Catalog: MG50935-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"