After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CHI3L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHI3L1cDNA Clone Product Information
Gene_bank_ref_id:NM_007695.3
cDNA Size:1170
cDNA Description:ORF Clone of Mus musculus chitinase 3-like 1 DNA.
Gene Synonym:Gp39, Brp39, AW208766, Chi3l1
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Chitinase-3-like protein 1 (CHI3L1) is a secreted heparin-binding glycoprotein whose expression is associated with vascular smooth muscle cell migration. CHI3L1 is expressed at high levels in postconfluent nodular VSMC cultures and at low levels in subconfluent proliferating cultures. CHI3L1 is a tissue-restricted, chitin-binding lectin and member of glycosyl hydrolase family 18. In contrast to many other monocyto / macrophage markers, its expression is absent in monocytes and strong induced during late stages of human macrophage differentiation. Elevated levels of CHI3L1 are associated with disorders exhibiting increased connective tissue turnover, such as rheum atoid, arthritis, osteoarthritis, scleroderma, and cirrhosis of liver, but is produced in cartilage from old donors or patiens with osteoarthritis. CHI3L1 is abnormally expressed in the hippocampus of subjects with schizophrenia and may be involved in the cellular response to various environmental events that are reported to increase the risk of schizophrenia.

References
  • Zhao XZH, et al. (2007) Functional Variants in the Promoter Region of Chitinase 3-Like 1 (CHI3L1) and Susceptibility to Schizophrenia.The American Journal of Human Genetics. 80 (1): 12-18.
  • Rehli M, et al. (2003) Transcriptional Regulation of CHI3L1, a Marker Gene for Late Stages of Macrophage Differentiation . The Journal of Biological Chemistry. 278: 44058-67.
  • Nishikawa KC, et al. (2003) gp38k (CHI3L1) is a novel adhesion and migration factor for vascular cells. Experimental Cell Research. 287 (1): 79-87
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"