Quick Order

Human ERH Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ERHcDNA Clone Product Information
cDNA Size:315
cDNA Description:ORF Clone of Homo sapiens enhancer of rudimentary homolog (Drosophila) DNA.
Gene Synonym:DROER
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

ERH(enhancer of rudimentary homolog) belongs to the E(R) family. It is expressed in all tissues examined. The monomeric structure of ERH comprises a single domain consisting of three α-helices and four β-strands, which is a novel fold. In the crystal structure, ERH assumes a dimeric structure, through interactions between the β-sheet regions. The formation of an ERH dimer is consistent with the results of analytical ultracentrifugation. ERH may have a role in the cell cycle. The Drosophila protein ERH is a small protein of 104 amino acids. It has been found to be an enhancer of the rudimentary gene, involved in pyrimidine biosynthesis. From an evolutionary point of view, ERH is highly conserved and has been found to exist in probably all multicellular eukaryotic organisms. ERH interacts with POLDIP3.

  • Wojcik E, et al. (1994) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.
  • Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.
  • Gelsthorpe M, et al. (1997) The putative cell cycle gene, enhancer of rudimentary, encodes a highly conserved protein found in plants and animals. Gene. 186(2):189-95.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items