Quick Order

Text Size:AAA

Rat NPM1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NPM1cDNA Clone Product Information
cDNA Size:879
cDNA Description:ORF Clone of Rattus norvegicus nucleophosmin (nucleolar phosphoprotein B23, numatrin) DNA.
Gene Synonym:B23NP
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.