Quick Order

Mouse CCNE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCNE1cDNA Clone Product Information
cDNA Size:1227
cDNA Description:ORF Clone of Mus musculus cyclin E1 DNA.
Gene Synonym:AW538188, Ccne1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Cyclin E1 is a member of the highly conserved cyclin family and belongs to the E-type cyclin that functions as a regulator of S phase entry and progression in mammalian cells. Cyclin E1 serves as regulatory subunits that bind, activate, and provide substrate for its associated cyclin-dependent kinase2 (CDK2), whose activity is essential for cell cycle G1 / S transition. Over expression of this encoding gene has been found in many tumors, which results in chromosome instability and by extension, induce tumorigenesis. This protein was also found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. In general, cyclin E1, as an activator of phospho-CDK2 (pCDK2), is important for cell cycle progression and is frequently overexpressed in cancer cells.

  • Honda R, et al. (2005) The structure of cyclin E1 / CDK2: implications for CDK2 activation and CDK2-independent roles. The EMBO Journal. 24: 452-63.
  • Geng Y, et al. (2007) Kinase-Independent Function of Cyclin E. 25(1): 127-39.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks