After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PBKcDNA Clone Product Information
Gene_bank_ref_id:NM_023209.2
cDNA Size:993
cDNA Description:ORF Clone of Mus musculus PDZ binding kinase DNA.
Gene Synonym:TOPK, AW538537, D14Ertd732e, 2810434B10Rik, Pbk
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50887-ACG$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50887-ACR$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50887-ANG$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50887-ANR$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50887-CF$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50887-CH$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50887-CM$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50887-CY$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone)MG50887-G$125
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50887-NF$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50887-NH$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50887-NM$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50887-NY$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50887-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

PDZ binding kinase (PBK), also known as TOPK (T-LAK cell-originated protein kinase), is a serine/threonine kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family, and has all the characteristic protein kinase subdomains and a C-terminal PDZ-binding T/SXV motif. PBK is expressed in the testis restrictedly expressed in outer cell layer of seminiferous tubules, as well as placenta. PBK may be enrolled in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis.This mitotic kinase phosphorylates MAP kinase p38 and seems to be active in mitosis. When phosphorylated, PBK forms a protein-protein interaction with tumor suppressor p53 (TP53), leading to TP53 destabilization and attenuation of G2/M checkpoint during doxorubicin-induced DNA damage. The expression level of PBK is thus upregulated in a variety of neoplasms including hematological malignancies.

Size / Price
Catalog:MG50887-CH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"