After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TRIB2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TRIB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_144551.5
RefSeq ORF Size:1032bp
cDNA Description:Full length Clone DNA of Mus musculus tribbles homolog 2 (Drosophila) with C terminal His tag.
Gene Synonym:TRB2, TRB-2, AW319517, Trib2
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Tribbles homolog 2, also known as TRB-2, and Trib2, is a member of the protein kinase superfamily and Tribbles subfamily (Trib1, Trib2, Trib3). The identification of tribbles as regulators of signal processing systems and physiological processes, including development, together with their potential involvement in diabetes and cancer, has generated considerable interest in these proteins. Tribbles have been reported to regulate activation of a number of intracellular signalling pathways with roles extending from mitosis and cell activation to apoptosis and modulation of gene expression. Tribbles controls the timing of mitosis in the prospective mesoderm, allowing cell-shape changes to be completed. This mechanism for coordinating cell division and cell-shape changes may have helped Drosophila to evolve its mode of rapid early development. Trib2 was identified as a downregulated transcript in leukemic cells undergoing growth arrest. Trib2-transduced bone marrow cells exhibited a growth advantage and readily established factor-dependent cell lines. Trib2-reconstituted mice uniformly developed fatal transplantable acute myelogenous leukemia (AML).

References
  • Seher, TC. et al., 2000, Curr Biol. 10 (11): 623-9.
  • Keeshan, K. et al., 2006, Cancer Cell. 10 (5): 401-11.
  • Hegedus, Z. et al., 2007, Cell Signal. 19 (2):238-50.
  • Keeshan, K. et al., 2008, Blood Cells Mol Dis. 40 (1): 119-21.
  • Cvetkovic, LV. et al., 2010, J Clin Invest. 120 (3): 713-9.
  • Size / Price
    Catalog: MG50885-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"