After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat METTL1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat METTL1 cDNA Clone Product Information
Gene_bank_ref_id:XM_001054797.3
RefSeq ORF Size:804bp
cDNA Description:Full length Clone DNA of Rattus norvegicus methyltransferase like 1 with N terminal Flag tag.
Gene Synonym:Mettl1
Species:Rat
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

tRNA (guanine-N(7)-)-methyltransferase, also known as Methyltransferase-like protein 1, tRNA (m7G46)-methyltransferase and METTL1, is a nucleus protein which belongs to the methyltransferase superfamily and TrmB family. METTL1 gene, has been identified by its sequence similarity to the yeast ORF YDL201w. The human cDNA and the genomic structure of METTL1 have been analyzed. The transcript contains 1292 nucleotides and codes for a protein of 276 amino acids. The METTL1 gene product shows high sequence similarities to putative proteins from mouse, Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, and yeast (39.8% identity between all six species). Computer analyses of the deduced protein sequence reveal two highly conserved amino acid motifs, one of which is typical for methyltransferases. Both motifs are also present in hypothetical proteins from eubacteria. Disruption of the homologous yeast ORF YDL201w shows that the gene is at least not essential for vegetative growth in Saccharomyces cerevisiae.

References
  • Bahr, A.et al., 1999, Genomics. 57 (3):424-8.
  • Wikman, H. et al., 2005,Genes Chromosomes Cancer. 42 (2):193-9.
  • Cartlidge, RA. et al., 2005, EMBO J. 24 (9):1696-705.
  • Size / Price
    Catalog: RG80983-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"