After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat RAC2 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat RAC2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001008384.1
RefSeq ORF Size:579bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) with N terminal Flag tag.
Gene Synonym:Rac2
Species:Rat
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Ras-related C3 botulinum toxin substrate 2 (Rac2) is a small G-protein belonging to the Ras subfamily of the GTPase family. Rac2 acts as an "on / off" switch for signal transduction cascades and motilities. When GDP is attached to the small G-protein, the enzyme is inactivated. Release of the GDP and replace of the GTP cativate the GTPasee. Rac2 remains active until the GTP is hydrolyzed to GDP. Rac2 is a hematopoietic-specific Rho family GTPase implicated as an important constituent of the NADPH oxidase complex and shares 92% amino acid identity with the ubiquitously expressed Rac1. The small G-protein Rac2 regulates the rearrangements of actin and membrane necessary for Fcy receptor-mediated phagocytosis by macrophages. Activated Rac2 binds to the p21-binding domain of PAK1 and this binding provided a basis for microscopic methods to localize activation of these G proteins inside cells.

References
  • Adam D, et al. (2003) Cdc42, Rac1, and Rac2 Display Distinct Patterns of Activation during Phagocytosis.Mol Biol Cell. 15 (8 ): 3509-19.
  • Walmsley MJ, et al. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302 (5644): 459-62.
  • Holland M, et al. (2011) RAC2, AEP, and ICAM1 expression are associated with CNS disease in a mouse model of pre-B childhood acute lymphoblastic leukemia. Blood. 118 (3): 638-49.
  • Size / Price
    Catalog: RG80966-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"