Quick Order

Text Size:AAA

Rat SRI Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SRIcDNA Clone Product Information
Gene_bank_ref_id:NM_001128190.1
cDNA Size:597
cDNA Description:ORF Clone of Rattus norvegicus sorcin DNA.
Gene Synonym:Sri
Species:Rat
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Sorcin was originally identified in multidrug-resistant cells. It is a alcium-binding protein. Sorcin modulates excitation-contraction coupling in the heart, contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Sorcin is overexpressed in the multi-drug resistant chinese hamster ovary cell line CHRC5 and a variety of multidrug-resistant tumor cell lines, but overexpression is not a sufficient or necessary condition for the acquisition of the multidrug-resistant phenotype.

References
  • Meyers MB, et al. (1995) Association of sorcin with the cardiac ryanodine receptor. J Biol Chem. 270(44):26411-8.
  • Brownawell AM, et al. (1997) Calcium-dependent binding of sorcin to the N-terminal domain of synexin (annexin VII). J Biol Chem. 272(35):22182-90.
  • Hansen, et al. (2003) The PEF family proteins sorcin and grancalcin interact in vivo and in vitro. FEBS Lett. 545(2-3):151-4.
  • Size / Price
    Catalog:RG80964-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"