Quick Order

Mouse NXPH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NXPH1cDNA Clone Product Information
cDNA Size:816
cDNA Description:ORF Clone of Mus musculus neurexophilin 1 DNA.
Gene Synonym:C130005L03Rik, Nxph1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Neurexophilin-1, or NXPH1 is a secreted glycoprotein, which belongs to the Neurexophilin family. The Neurexophilin family contain at least four genes and resembles a neuropeptide, suggesting a function as an endogenous ligand for alpha-neurexins. The mammalian brains contain four genes for neurexophilins the products of which share a common structure composed of five domains: an N-terminal signal peptide, a variable N-terminal domain, a highly conserved central domain that is N-glycosylated, a short linker region, and a conserved C-terminal domain that is cysteine-rich. Neurexophilin-1 constitutes a secreted cysteine-rich glycoprotein, forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. Neurexophilins 1 and 3 but not 4 (neurexophilin 2 is not expressed in rodents) bind to a single individual LNS domain, the second overall LNS domain in all three alpha-neurexins.

  • Missler M, et al. (1998) Neurexophilin binding to alpha-neurexins. A single LNS domain functions as an independently folding ligand-binding unit. J Biol Chem. 273(52): 34716-23.
  • Missler M, et al. (1998) Neurexophilins form a conserved family of neuropeptide-like glycoproteins. J Neurosci. 18(10): 3630-8.
  • Petrenko AG, et al. (1996) Structure and evolution of neurexophilin. J Neurosci. 16(14): 4360-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks