After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CPB2 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CPB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_053617.2
RefSeq ORF Size:1269bp
cDNA Description:Full length Clone DNA of Rattus norvegicus carboxypeptidase B2 (plasma) with N terminal Flag tag.
Gene Synonym:Cpb2
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Carboxypeptidase B2, also known as Carboxypeptidase U, Thrombin-activable fibrinolysis inhibitor, Plasma carboxypeptidase B, CPB2, is a secreted protein which belongs to the peptidase M14 family. Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). CPB2 is activated by thrombin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. CPB2 is synthesized by the liver and circulates in the plasma as a plasminogen-bound zymogen. When it is activated by proteolysis at residue Arg92 by the thrombin / thrombomodulin complex. CPB2 cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. CPB2 exhibits carboxypeptidase activity and activated CPB2 reduces fibrinolysis by removing the fibrin C-terminal residues that are important for the binding and activation of plasminogen.

References
  • Eaton DL. et al.,1991, J Biol Chem. 266 (32): 21833-8.
  • Boffa MB. et al.,1999, Biochemistry. 38 (20): 6547-58.
  • Liu T. et al., 2005, J. Proteome Res. 4: 2070-80.
  • Valnickova Z. et al., 2006, Biochemistry. 45: 1525-35.
  • Chen R. et al., 2009, J. Proteome Res. 8: 651-61.
  • Size / Price
    Catalog: RG80947-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"