Quick Order

Text Size:AAA

Mouse GSTZ1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GSTZ1 cDNA Clone Product Information
Gene_bank_ref_id:NM_010363.4
RefSeq ORF Size:651bp
cDNA Description:Full length Clone DNA of Mus musculus glutathione transferase zeta 1 (maleylacetoacetate isomerase) with N terminal Myc tag.
Gene Synonym:MAAI
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

GSTZ1 gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. GSTZ1 is a bifunctional protein which has minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. GSTZ1 catalyzes the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. GSTZ1 participates in the catabolism of phenylalanine and tyrosine. Thus defects in GSTZ1 cause harsh metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia.

References
  • Tong Z. et al., 1999, Chem Res Toxicol. 11 (11): 1332-8.
  • Tong Z. et al., 1999, Biochem J. 331 (2): 371-4.
  • Ketterer B. 2001, Chem Biol Interact. 138 (1): 27-42.
  • Size / Price
    Catalog: MG51808-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"