After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CDC37 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CDC37 cDNA Clone Product Information
Gene_bank_ref_id:NM_016742.4
RefSeq ORF Size:1140bp
cDNA Description:Full length Clone DNA of Mus musculus cell division cycle 37 homolog (S. cerevisiae) with C terminal His tag.
Gene Synonym:p50, p50Cdc37, Cdc37
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp90. Decreased Hsp90 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp90's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.

References
  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.
  • Size / Price
    Catalog: MG50826-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"