Quick Order

Rat RCN3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RCN3cDNA Clone Product Information
cDNA Size:987
cDNA Description:ORF Clone of Rattus norvegicus reticulocalbin 3, EF-hand calcium binding domain DNA.
Gene Synonym:Rem1, Rlp49
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

RCN3 belongs to the CREC family which contains multiple EF-hand Ca2+-binding proteins localized to the secretory pathway. RCN3 sequence is characterized by the presence of five Arg-Xaa-Xaa-Arg motifs, which represents the target sequence of subtilisin-like proprotein convertases(SPCs). SPCs are a family of seven structurally related serine endoproteases that are involved in the proteolytic activation of proproteins.RCN3 is transiently associated with proPACE4, but not with mature PACE4. Inhibition of PACE4 maturation by a Ca2+ ionophore resulted in accumulation of the proPACE4-RCN-3 complex in cells. It has been proposed that elective and transient association of RCN3 with the precursor of PACE4 plays an important role in the biosynthesis of PACE4.

  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Kamatani Y, et al. (2010) Genome-wide association study of hematological and biochemical traits in a Japanese population. Nat Genet. 42(3):210-5.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items