After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse IL3Ra Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL3RAcDNA Clone Product Information
cDNA Size:1191
cDNA Description:ORF Clone of Mus musculus interleukin 3 receptor, alpha chain DNA.
Gene Synonym:CD123, SUT-1, CDw123
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Other Interleukin & Receptor Related Products
Product nameProduct name
Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Human IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13 / ALRH Protein (Fc Tag)Human IL13 / ALRH ProteinHuman IL5Ra / CD125 Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, His Tag)Human IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinHuman IL13RA1 Protein (His & Fc Tag)Human IL13RA1 Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Cynomolgus IL13 / ALRH ProteinHuman Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman Interleukin-2 / IL-2 ProteinHuman IL-3 / Interleukin-3 Protein (His Tag)Mouse IL-4R / CD124 Protein (ECD, His Tag)Mouse IL4 / Interleukin-4 ProteinMouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Mouse IL13 / ALRH ProteinMouse IL2RA / CD25 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Mouse IL5Ra / CD125 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinCanine IL13RA2 / IL13R Protein (His Tag)Human IL5 / Interleukin 5 ProteinRat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL2RA ProteinCynomolgus IL-8 / CXCL8 ProteinMouse IL16 / Interleukin-16 Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

  • Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.
  • Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.
  • Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items