Quick Order

Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDK2cDNA Clone Product Information
cDNA Size:897
cDNA Description:ORF Clone of Mus musculus cyclin-dependent kinase 2, transcript variant 2 DNA.
Gene Synonym:A630093N05Rik, Cdk2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50796-ACG$325
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50796-ACR$325
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50796-ANG$325
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50796-ANR$325
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50796-CF$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50796-CH$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50796-CM$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50796-CY$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)MG50796-G$125
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50796-NF$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50796-NH$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50796-NM$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50796-NY$295
Mouse CDK2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50796-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

CDK2 is a member of the Ser/Thr protein kinase family. This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2. It is a catalytic subunit of the cyclin-dependent protein kinase complex, whose activity is restricted to the G1-S phase, and essential for cell cycle G1/S phase transition. Cdks (cyclin-dependent kinases) are heteromeric serine/threonine kinases that control progression through the cell cycle in concert with their regulatory subunits, the cyclins. Cdks are constitutively expressed and are regulated by several kinases and phosphastases, including Wee1, CDK-activating kinase and Cdc25 phosphatase. Although there are 12 different cdk genes, only 5 have been shown to directly drive the cell cycle (Cdk1, -2, -3, -4, and -6). Following extracellular mitogenic stimuli, cyclin D gene expression is upregulated. Cdk4 forms a complex with cyclin D and phosphorylates Rb protein, leading to liberation of the transcription factor E2F. E2F induces transcription of genes including cyclins A and E, DNA polymerase and thymidine kinase. Cdk4-cyclin E complexes form and initiate G1/S transition. Subsequently, Cdk1-cyclin B complexes form and induce G2/M phase transition. Cdk1-cyclin B activation induces the breakdown of the nuclear envelope and the initiation of mitosis. CDK2 associates with and regulated by the regulatory subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A) and p27Kip1 (CDKN1B). Its activity is also regulated by its protein phosphorylation. CDK2 is involved in the control of the cell cycle. It also interacts with cyclins A, B1, B3, D, or E. Activity of CDK2 is maximal during S phase and G2.

  • Bao ZQ, et al. (2011) Briefly bound to activate: transient binding of a second catalytic magnesium activates the structure and dynamics of CDK2 kinase for catalysis. Structure. 19(5):675-90.
  • Neganova I, et al. (2011) An important role for CDK2 in G1 to S checkpoint activation and DNA damage response in human embryonic stem cells. Stem Cells. 29(4):651-9.
  • Li J, et al. (2011) Phosphorylation of MCM3 protein by cyclin E/cyclin-dependent kinase 2 (Cdk2) regulates its function in cell cycle. J Biol Chem. 286(46):39776-85.
  • Buis J, et al. (2012) Mre11 regulates CtIP-dependent double-strand break repair by interaction with CDK2. Nat Struct Mol Biol. 19(2):246-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items