Quick Order

Mouse PRKCI Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRKCIcDNA Clone Product Information
cDNA Size:1788
cDNA Description:ORF Clone of Mus musculus protein kinase C, iota DNA.
Gene Synonym:Pkci, Pkcl, Prkcl, AI427505, KIAA4165, PKClambda, mKIAA4165, aPKClambda, 2310021H13Rik, Prkci
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Protein kinase C iota type, also known as Atypical protein kinase C-lambda/iota, aPKC-lambda/iota and PRKCI, is a cytoplasm, membrane and nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and PKC subfamily. PRKCI contains one AGC-kinase C-terminal domain, one OPR domain, one phorbol-ester/DAG-type zinc finger and one protein kinase domain. PRKCI is predominantly expressed in lung and brain, but also expressed at lower levels in many tissues including pancreatic islets. It is highly expressed in non-small cell lung cancers. PRKCI is a calcium-independent, phospholipid-dependent, serine- and threonine-specific kinase. It may play a role in the secretory response to nutrients. PRKCI is involved in cell polarization processes and the formation of epithelial tight junctions. It is implicated in the activation of several signaling pathways including Ras, c-Src and NF-kappa-B pathways. PRKCI functions in both pro- and anti-apoptotic pathways. It functions in the RAC1/ERK signaling required for transformed growth. PRKCI plays a role in microtubule dynamics through interaction with RAB2A and GAPDH and recruitment to vesicular tubular clusters (VTCs). PRKCI might be a target for novel lipid activators that are elevated during nutrient-stimulated insulin secretion.

  • Selbie L.A. et al.,1993, J. Biol. Chem. 268:24296-302.
  • Diaz-Meco M.T. et al.,1996, Mol. Cell. Biol. 16:105-114.
  • Noda Y. et al.,2001, Genes Cells 6:107-119.
  • White W.O.et al.,2002, J. Cell. Biochem. 85:42-53.
  • Messerschmidt A. et al., 2005, J. Mol. Biol. 352:918-931.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items