After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ATL1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ATL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_178628.5
RefSeq ORF Size:1677bp
cDNA Description:Full length Clone DNA of Mus musculus atlastin GTPase 1 with C terminal His tag.
Gene Synonym:Fsp1, Spg3, Adfsp, Spg3a, 4930435M24Rik, Atl1
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.

Size / Price
Catalog: MG50784-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"