Quick Order

Text Size:AAA

Rat CALML5 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CALML5 cDNA Clone Product Information
Gene_bank_ref_id:XM_001062982.2
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Rattus norvegicus calmodulin-like 5 with N terminal Flag tag.
Gene Synonym:Calm4
Species:Rat
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Calmodulin-like protein 5, also known as Calmodulin-like skin protein, CALML5 and CLSP, is a protein which contains four EF-hand domains. CALML5 / CLSP is particularly abundant in the epidermis where its expression is directly related to keratinocyte differentiation.The expression is very low in lung. CALML5 / CLSP binds calcium. It may be involved in terminal differentiation of keratinocytes. Coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin (Ig) superfamily and a component of epithelial tight junction. CAR functions as a primary receptor for coxsackievirus B and adenovirus (Ad) infection. CALML5 / CLSP is closely related to CAR. The structure and dynamics of human calmodulin-like skin protein CALML5 / CLSP have been characterized by NMR spectroscopy. The mobility of CALML5 / CLSP has been found to be different for the N-terminal and C-terminal domains. The N-terminal domain is characterized by four stable helices, which experience large fluctuations. This is shown to be due to mutations in the hydrophobic core. The overall N-terminal domain behavior is similar both in the full-length protein and in the isolated domain.

References
  • Mehul B., et al., 2000, J. Biol. Chem. 275:12841-12847.
  • Babini E., et al., 2006, Structure 14:1029-1038.
  • Kawabata,K. et al., 2007, Gene Ther. 14 (16):1199-207.
  • Size / Price
    Catalog: RG80799-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"