Quick Order

Text Size:AAA

Mouse ST6GALNAC2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ST6GALNAC2 cDNA Clone Product Information
NCBI RefSeq:NM_009180.3
RefSeq ORF Size:1122bp
cDNA Description:Full length Clone DNA of Mus musculus ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 with C terminal His tag.
Gene Synonym:II, Siat7, Siat7b, ST6GalNAc, St6galnac2
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Li GS, et al. (2007) Variants of the ST6GALNAC2 promoter influence transcriptional activity and contribute to genetic susceptibility to IgA nephropathy. Hum Mutat. 28(10): 950-7.
  • Ding JX, et al. (2009) Activity of alpha2,6-sialyltransferase and its gene expression in peripheral B lymphocytes in patients with IgA nephropathy. Scand J Immunol. 69(2): 174-80.
  • Kiryluk K, et al. (2010) Genetic studies of IgA nephropathy: past, present, and future. Pediatr Nephrol. 25(11): 2257-68.
  • Size / Price
    Catalog: MG50774-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"