Quick Order

Text Size:AAA

Human ING5 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ING5 cDNA Clone Product Information
Gene_bank_ref_id:NM_032329.4
RefSeq ORF Size:723bp
cDNA Description:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 5 with C terminal HA tag.
Gene Synonym:p28ING5
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ING5 belongs to the ING family. It contains 1 PHD-type zinc finger and is a component of the HBO1 complex. HBO1 complex has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. HBO1 complex composed at least of ING4 or ING5, KAT7/HBO1, MEAF6, and one of PHF15, PHF16 and PHF17. ING5 also is a component of the MOZ/MORF complex which is composed at least of ING5, KAT6A, KAT6B, MEAF6 and one of BRPF1, BRD1/BRPF2 and BRPF3. It interacts with EP300 and TP53. MOZ/MORF complex has a histone H3 acetyltransferase activity. Through chromatin acetylation ING5 may regulate DNA replication and may function as a transcriptional coactivator. It interacts with H3K4me3 and to a lesser extent with H3K4me2. ING5 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. It can bind TP EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in TP53-dependent regulatory pathway.

References
  • Zhang F, et al. (2011) The inhibitor of growth protein 5 (ING5) depends on INCA1 as a co-factor for its antiproliferative effects. PLoS One. (7):e21505.
  • Zheng HC, et al. (2011) The nuclear to cytoplasmic shift of ING5 protein during colorectal carcinogenesis with their distinct links to pathologic behaviors of carcinomas. Hum Pathol. 42(3):424-33.
  • Xing YN, et al. (2011) The altered expression of ING5 protein is involved in gastric carcinogenesis and subsequent progression. Hum Pathol. 42(1):25-35.
  • Size / Price
    Catalog: HG15462-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"