Quick Order

Human CARHSP1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CARHSP1 cDNA Clone Product Information
Gene_bank_ref_id:BC003366
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium regulated heat stable protein 1, 24kDa with N terminal HA tag.
Gene Synonym:CRHSP-24, CSDC1, MGC111446, CARHSP1
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CARHSP1 is a biomarker for diabetic complications. Adenovirus-mediated CARHSP1 overexpression and siRNA-mediated knockdown experiments were performed to characterize the role of CARHSP1 in the regulation of gluconeogenic gene expression. CARHSP1 is regulated by nutrient status in the liver and functions at the transcriptional level to negatively regulate gluconeogenic genes, including the glucose-6-phosphatase catalytic subunit (G6Pc) and phosphoenolpyruvate carboxykinase 1 (PEPCK1). In addition, it is found that CARHSP1 can physically interact with peroxisome proliferator-activated receptor-α (PPARα) and inhibit its transcriptional activity. Both pharmacological and genetic ablations of PPARα attenuate the inhibitory effect of CARHSP1 on gluconeogenic gene expression in hepatocytes.

References
  • Wistow G. et al., 2002, Mol Vis. 8: 205-20.
  • Wishart MJ. et al., 2002, Proc Natl Acad Sci. 99 (4): 2112-7.
  • Groblewski GE. et al., 1998, J Biol Chem. 273 (35): 22738-44.
  • Fan Y. et al., 2011, J Biol Chem. 286 (47): 40584-94.
  • Size / Price
    Catalog: HG14333-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"