Quick Order

Rat CLPS Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLPScDNA Clone Product Information
Gene_bank_ref_id:NM_013139.1
cDNA Size:339
cDNA Description:ORF Clone of Rattus norvegicus colipase, pancreatic DNA.
Gene Synonym:COLQ
Species:Rat
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Colipase belongs to the colipase family. Structural studies of the complex and of colipase alone have revealed the functionality of its architecture. It is a small protein with five conserved disulphide bonds. Structural analogies have been recognised between a developmental protein, the pancreatic lipase C-terminal domain, the N-terminal domains of lipoxygenases and the C-terminal domain of alpha-toxin. Colipase can only be detected in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Colipase allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. Without colipase the enzyme is washed off by bile salts, which have an inhibitory effect on the lipase. Colipase is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilising as active conformation and considerably increasing the overall hydrophobic binding site.

References
  • Davis RC, et al. (1991) Assignment of the human pancreatic colipase gene to chromosome 6p21.1 to pter. Genomics. 10(1):262-5.
  • Lowe ME. (1997) Structure and function of pancreatic lipase and colipase. Annu Rev Nutr. 17: 141-58.
  • Verger R, et al. (1999) Colipase: structure and interaction with pancreatic lipase. Biochim Biophys Acta. 1441(2-3):173-84.
  • Size / Price
    Catalog:RG80729-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"