Quick Order

Text Size:AAA

Rat TPPP3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPPP3cDNA Clone Product Information
cDNA Size:531
cDNA Description:ORF Clone of Rattus norvegicus tubulin polymerization-promoting protein family member 3 DNA.
Gene Synonym:CGI-38, RGD1305061
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

TPPP3, a member of the Tubulin polymerization-promoting protein family, is an intrinsically unstructured protein that induces tubulin polymerization. TPPP3 is a marker in the developing musculoskeletal system. In tendons, Tppp3 is expressed in cells at the circumference of the developing tendons, likely the progenitors of connective tissues that surround tendons: the tendon sheath, epitenon, and paratenon. Tppp3 is also expressed in forming synovial joints. The onset of Tppp3 expression in joints coincides with cavitation, representing a molecular marker that can be used to indicate this stage in joint transition in joint differentiation. In late embryonic stages, Tppp3 expression highlights other demarcation lines that surround differentiating tissues in the forelimb.

Depletion of TPPP3 by microRNA-based RNA interference (RNAi) inhibits cell growth, arrests cell cycles, and causes mitotic abnormalities in HeLa cells. C57BL/6 mice that received subcutaneously injected LLC (Lewis lung carcinoma) cells in which TPPP3 was knocked down showed a pronounced reduction in tumor progression. The migration/invasion activity of TPPP3-knockdown LLC cells was significantly suppressed in a transwell chamber migration assay. When these cells were injected into the tail veins of C57BL/6 mice, they exhibited milder lung metastasis compared with control tumor cells. Taken together, these findings suggested that the TPPP3 gene played an important role in tumorigenesis and metastasis, and it could potentially become a novel target for cancer therapy.

  • Staverosky JA, et al. (2009) Tubulin polymerization-promoting protein family member 3, Tppp3, is a specific marker of the differentiating tendon sheath and synovial joints. Dev Dyn. 238(3):685-92.
  • Zhou W, et al. (2010) Stable knockdown of TPPP3 by RNA interference in Lewis lung carcinoma cell inhibits tumor growth and metastasis. Mol Cell Biochem. 343(1-2):231-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items