Quick Order

Mouse CD82 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD82cDNA Clone Product Information
cDNA Size:801
cDNA Description:ORF Clone of Mus musculus CD82 antigen DNA.
Gene Synonym:C33, Kai1, Tspan27, AA682076, AL023070, Cd82
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.

  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks