After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RYBP ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RYBP cDNA Clone Product Information
Gene_bank_ref_id:BC014959
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Homo sapiens RING1 and YY1 binding protein with N terminal HA tag.
Gene Synonym:AAP1, DEDAF, YEAF1, RYBP
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

APAP-1, also known as AAP1 and RYBP, is widely expressed. It is highest expressed in lymphoid tissues and placenta. APAP-1 contains 1 RanBP2-type zinc finger. It may bind to DNA. APAP-1 inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes. It may be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1. APAP-1 also promotes apoptosis.

References
  • Li Mao, et al. (2009) RYBP stabilizes p53 by modulating MDM2. EMBO Rep. 10(2):166-72.
  • Schlisio, et al. (2002) Interaction of YY1 with E2Fs, mediated by RYBP, provides a mechanism for specificity of E2F function. EMBO J. 21(21):5775-86.
  • Peter M E, et al. (2001) The death effector domain-associated factor plays distinct regulatory roles in the nucleus and cytoplasm. J Biol Chem. 276(34):31945-52.
  • Size / Price
    Catalog: HG14292-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"