Quick Order

Human CPNE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPNE1cDNA Clone Product Information
cDNA Size:1614
cDNA Description:ORF Clone of Homo sapiens copine I DNA.
Gene Synonym:RP1-309K20.2, COPN1, CPN1, MGC1142, CPNE1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Copine I, also known as CPN1, is a member of the copine family. Copine I is a calcium-dependent membrane-binding protein which has a wide tissue distribution. Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. Copine I contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus, while it does not contain a predicted signal sequence or transmembrane domains. Copine I may function in membrane trafficking.

  • Cowland JB, et al. (2003) Tissue expression of copines and isolation of copines I and III from the cytosol of human neutrophils. J Leukoc Biol. 74(3):379-88.
  • Tomsig JL, et al. (2003) Identification of targets for calcium signaling through the copine family of proteins. Characterization of a coiled-coil copine-binding motif. J Biol Chem. 278 (12):10048-54.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items