Quick Order

Text Size:AAA

Human ING4 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ING4 cDNA Clone Product Information
Gene_bank_ref_id:BC007781
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 4 with N terminal HA tag.
Gene Synonym:My036, MGC12557, my036, p29ING4, ING4
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ING4 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. ING4 contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. ING4 protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. ING4 is a component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Through chromatin acetylation it may function in DNA replication. ING4 may also inhibit tumor progression by modulating the transcriptional output of signaling pathways which regulate cell proliferation.

References
  • Shiseki M. et al., 2003, Cancer Res. 63 (10): 2373-8.
  • Garkavtsev. et al., 2004, Nature. 428 (6980): 328-32.
  • Tsai. et al., 2008, Exp Cell Res. 314 (17): 3130-41.
  • Size / Price
    Catalog: HG14264-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"