Quick Order

Human TBCB ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TBCB cDNA Clone Product Information
Gene_bank_ref_id:BC005969
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens tubulin folding cofactor B with N terminal HA tag.
Gene Synonym:CG22, CKAP1, CKAPI, MGC14625
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

References
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • Size / Price
    Catalog: HG14260-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"