Quick Order

Rat PNLIPRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PNLIPRP1cDNA Clone Product Information
Gene_bank_ref_id:NM_032081.1
cDNA Size:1422
cDNA Description:ORF Clone of Rattus norvegicus pancreatic lipase-related protein 1 DNA.
Gene Synonym:Pnliprp1
Species:Rat
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

PNLIPRP1, also known as PLRP1, belongs to the AB hydrolase superfamily, Lipase family. PNLIPRP1 is structurally similar to PLRP2. However, these two proteins display different functional properties. PNLIPRP1 may function as inhibitor of dietary triglyceride digestion. It lacks detectable lipase activity towards triglycerides, diglycerides, phosphatidylcholine, galactolipids or cholesterol esters. PLRP2 hydrolyses milk fat with a lower catalytic efficiency than that of PL. PLRP2 activity, higher on homogenized than on native milk fat, is differently influenced by fatty acids and colipase depending on a proteolytic cleavage in the lid domain.

References
  • Grupe A. et al., 2006, Am J Hum Genet. 78 (1): 78-88.
  • Strausberg RL. et al., 2002, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Giller T. et al., 1992, J Biol Chem. 267 (23): 16509-16.
  • Size / Price
    Catalog:RG80624-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"