Quick Order

Human ATP1B1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ATP1B1 cDNA Clone Product Information
NCBI RefSeq:BC000006
RefSeq ORF Size:912bp
cDNA Description:Full length Clone DNA of Homo sapiens ATPase, NA+/K+ transporting, beta 1 polypeptide with N terminal HA tag.
Gene Synonym:ATP1B, MGC1798, ATP1B1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ATP1B1 belongs to the family of Na+/K+ and H+/K+-ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. ATP1B1 is a subunit of Na+/K+-ATPase. Na+/K+-ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. Na+/K+-ATPase is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). ATP1B1 regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. ATP1B1 is the non-catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with which catalyzes the hydrolysis of ATP coupled with the exchange of Na+ and K+ ions across the plasma membrane.

References
  • Lingrel JB. et al., 1990, Prog Nucleic Acid Res Mol Biol. 38: 37-89.
  • Oakey RJ. et al., 1993, Hum Mol Genet. 1 (8): 613-20.
  • Ushkaryov YuA. et al., 1990, FEBS Lett. 257 (2): 439-42.
  • Size / Price
    Catalog: HG14255-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"