Quick Order

Text Size:AAA

Rat SELM ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat SELM cDNA Clone Product Information
Gene_bank_ref_id:NM_001115013.1
RefSeq ORF Size:438bp
cDNA Description:Full length Clone DNA of Rattus norvegicus selenoprotein M with N terminal Flag tag.
Gene Synonym:Selm
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Selenoprotein M is a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine M is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This gene is expressed in a variety of tissues, and the protein is localized to the perinuclear structures. Selenoprotein M May function as a thiol-disulfide oxidoreductase that participates in disulfide bond formation. This protein is widely expressed and is highly expressed in brain. It is found in Cytoplasm, perinuclear region, Endoplasmic reticulum, Golgi apparatus. Localized to perinuclear structures corresponding to Golgi and endoplasmic reticulum. Experiments results have suggested that selenoprotein M may have an important role in protecting against oxidative damage in the brain and may potentially function in calcium regulation.

References
  • Reeves MA, et al. (2010) The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation. Antioxid Redox Signal. 12(7): 809-18.
  • Lu W, et al. (2012) Reproductive function of Selenoprotein M in Chinese mitten crabs (Eriocheir sinesis). Peptides. 34(1): 168-76.
  • Garcia-Triana A, et al. (2010) Expression and silencing of Selenoprotein M (SelM) from the white shrimp Litopenaeus vannamei: effect on peroxidase activity and hydrogen peroxide concentration in gills and hepatopancreas. Comp Biochem Physiol A Mol Integr Physiol. 155(2): 200-4.
  • Size / Price
    Catalog: RG80607-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"