After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IFNA14 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
IFNA14cDNA Clone Product Information
Gene Bank Ref.ID:NM_206975.1
cDNA Size:570
cDNA Description:ORF Clone of Mus musculus interferon, alpha 14 DNA.
Gene Synonym:MGC155959, RP23-67C1.2, OTTMUSG00000007662, Ifna14
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Interferon & Receptor Related Products
Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinCynomolgus IFNAR1 / IFNAR ProteinCynomolgus / Rhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Cynomolgus / Rhesus IFNG / Interferon Gamma ProteinHuman IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon alpha-B / IFNA8 ProteinHuman Interferon alpha 10 / IFNA10 Protein (Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB ProteinHuman Interferon alpha-B / IFNA8 Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinMouse IFNGR2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinMouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Cynomolgus / Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Ferret IFNG / Interferon Gamma Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Rat IFNA5 / IFNaG Protein (His Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (His Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNAR1 / IFNAR Protein (His Tag)Cynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Cynomolgus IFN gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Cynomolgus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Cynomolgus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)
  • Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.
  • Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.
  • Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks