After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse MAP2K4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP2K4cDNA Clone Product Information
cDNA Size:1194
cDNA Description:ORF Clone of Mus musculus mitogen-activated protein kinase kinase 4 DNA.
Gene Synonym:MEK4, MKK4, Sek1, JNKK1, Serk1, PRKMK4, Map2k4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Mouse dual specificity mitogen-activated protein kinase kinase 4, also known as MAP kinase kinase 4, MAPKK4, JNK-activating kinase 1, MAPK/ERK kinase 4, SAPK/ERK kinase 1, c-Jun N-terminal kinase kinase 1, JNKK and MAP2K4, is a protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K4 / JNKK1 is a protein kinase which is a direct activator of MAP kinases in response to various environmental stresses or mitogenic stimuli. MAP2K4 / JNKK1 has been shown to activate MAPK8 / JNK1, MAPK9 / JNK2, and MAPK14 / p38, but not MAPK1 / ERK2 or MAPK3 / ERK1. MAP2K4 / JNKK1 is phosphorylated, and thus activated by MAP3K1 / MEKK. The stress-activated protein kinase (SAPK) pathways represent phosphorylation cascades that convey pro-apoptotic signals. The mitogen-activated protein kinase kinase (MAPKK) homolog MAP2K4 ( MKK4, SEK, JNKK1 ) is a centrally-placed mediator of the SAPK pathways.

  • Lin A, et al.,1995, Science 268 (5208): 286-90.
  • Su,G.H. et al., 2002, Hum Mutat. 19 (1):81.
  • Lee, et al., 2002, Proc. Natl. Acad. Sci. USA. 99 (22): 14189-94.
  • Bouzakri,K. et al., 2007, J Biol Chem. 282 (11):7783-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items