After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SMPD1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SMPD1 cDNA Clone Product Information
RefSeq ORF Size:1896bp
cDNA Description:Full length Clone DNA of Homo sapiens sphingomyelin phosphodiesterase 1, acid lysosomal with Flag tag.
Gene Synonym:ASM, NPD, SMPD1
Restriction Site:HindIII + XbaI (5.4kb + 1.95kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Sphingomyelin phosphodiesterase 1 (SMPD1) , also known as ASM ( acid sphingomyelinase ), is a member of the acid sphingomyelinase family of enzymes. Three isoforms have been identified, isoform 1 is 631 amino acids (aa) in length as the pro form, while Isoform 2 and isoform 3 have lost catalytic activity. The active SMPD1 isoform 1 contains one saposin B-type domain that likely interacts with sphingomyelin, and a catalytic region. Human SMPD1 is 86% aa identical to mouse SMPD1. SMPD1 is a monomeric lysosomal enzyme that converts sphingomyelin (a plasma membrane lipid ) into ceramide through the removal of phosphorylcholine. This generates second messenger components that participate in signal transduction. Defects in SMPD1 are the cause of Niemann-Pick disease type A (NPA) and type B (NPB), also known as Niemann-Pick disease classical infantile form and Niemann-Pick disease visceral form. Niemann-Pick disease is a clinically and genetically heterogeneous recessive disorder. NPB has little if any neurologic involvement and patients may survive into adulthood.

Size / Price
Catalog: HG11087-M-F
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions