After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PHKG1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PHKG1cDNA Clone Product Information
cDNA Size:1164
cDNA Description:ORF Clone of Homo sapiens phosphorylase kinase, gamma 1 (muscle) DNA.
Gene Synonym:PHKG
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Phosphorylase b kinase gamma catalytic chain, skeletal muscle isoform, also known as Phosphorylase kinase subunit gamma-1 and PHKG1, is a member of the protein kinase superfamily and CAMK Ser/Thr protein kinase family. PHKG1 is the catalytic member of a 16 subunit protein kinase complex which contains equimolar ratios of 4 subunit types. The complex is a crucial glycogenolytic regulatory enzyme. Muscle glycogenosis caused by phosphorylase kinase (Phk) deficiency may lead to exercise intolerance, weakness and musculatur atrophy. The gene encoding the muscle isoform of the Phk gamma subunit (gamma M) is one of the candidate genes in which mutations responsible for this condition should be sought. Muscle-specific deficiency of Phk causes glycogen storage disease, clinically manifesting in exercise intolerance with early fatiguability, pain, cramps and occasionally myoglobinuria. 

  • Wehner, M. et al., 1995, Hum Genet. 96 (5): 616-8.
  • Burwinkel, B. et al., 2003, Eur J Hum Genet. 11 (7): 516-26.
  • Winchester, JS. et al., 2007, Mol Genet Metab. 92 (3): 234-42.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items