Quick Order

Text Size:AAA

Mouse PGK1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PGK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_008828.2
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Mus musculus phosphoglycerate kinase 1 with C terminal His tag.
Gene Synonym:Pgk-1, MGC118097, Pgk1
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • Size / Price
    Catalog: MG50628-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"