After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TNNC1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TNNC1cDNA Clone Product Information
Gene_bank_ref_id:NM_003280.2
cDNA Size:486
cDNA Description:ORF Clone of Homo sapiens troponin C type 1 (slow) DNA.
Gene Synonym:TNC, TNNC, CMD1Z
Species:Human
Vector:pCMV2-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human TNNC1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged on other vectors
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11011-ACG$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11011-ACR$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11011-ANG$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11011-ANR$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11011-CF$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11011-CH$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11011-CM$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11011-CY$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone)HG11011-M$95
Human TNNC1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG11011-M-F$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG11011-M-N$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11011-NF$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11011-NH$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11011-NM$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11011-NY$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11011-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Troponin I, also known as TNNC1, is part of the troponin complex. This complex contains 3 subunits: troponin I (TnI), troponin T (TnT) and troponin C (TnC). Troponin I is the inhibitory subunit, blocking actin-myosin interactions and thereby mediating striated muscle relaxation. It binds to actin in thin myofilaments to hold the actin-tropomyosin complex in place. Because of it myosin cannot bind actin in relaxed muscle. When calcium binds to the Troponin C it causes conformational changes which lead to dislocation of troponin I and finally tropomyosin leaves the binding site for myosin on actin leading to contraction of muscle.

References
  • Kalaji FR. et al., 2012, Saudi J Kidney Dis Transpl. 23 (5): 939-45.
  • Wijnker PJ. et al., 2013, Am J Physiol Heart Circ Physiol. 304 (2): H260-8.
  • Solaro RJ. et al., 2013, Circ Res. 112 (2): 355-66.
  • Size / Price
    Catalog:HG11011-M-F
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"