After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SERPINB3C ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SERPINB3C cDNA Clone Product Information
NCBI RefSeq:NM_201363.2
RefSeq ORF Size:1161bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 3C with C terminal His tag.
Gene Synonym:Scca2, Serpinb4, 1110001H02Rik, 1110013A16Rik, Serpinb3c
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Mouse SerpinB3, also known as Squamous cell carcinoma antigen 1, SCCA-1, SERPINB3, SCCA and SCCA1, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB3 may act as a protease inhibitor to modulate the host immune response against tumor cells. Mouse SerpinB3a and SerpinB3b, but not Serpinb3c, are functional, inhibiting both serine and cysteine proteinases with different inhibitory profiles due to the difference of two amino acids in their reactive site loops. SerpinB3a is ubiquitously expressed in most tissues, whereas expression of SerpinB3b is limited to keratinocytes. SerpinB3a and SerpinB3b may play different roles by inhibiting intrinsic or extrinsic proteinases with different expression distributions and different inhibitory profiles.

References
  • Sakata,Y. et al., 2004, Biochem Biophys Res Commun.324 (4):1340-5.
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30. 
  • Size / Price
    Catalog: MG50625-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"