After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPRCcDNA Clone Product Information
cDNA Size:3921
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, receptor type, C transcript variant 1 DNA.
Gene Synonym:LCA, LY5, B220, CD45, L-CA, T200, CD45R, GP180
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.