After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL10 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

IL-10 is a anti-inflammatory cytokine which belongs to the IL-10 family. It is produced by a variety of cell lines, including T-cells, macrophages, mast cells and other cell types, while it is produced primarily by monocytes and to a lesser extent by lymphocytes. IL-10 is mainly expressed in monocytes and Type 2 T helper cells (TH2), mast cells, CD4+CD25+Foxp3+ regulatory T cells, and also in a certain subset of activated T cells and B cells. IL-10 has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. IL-10 can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. The importance of interleukin 10 for counteracting excessive immunity in the human body is revealed by the fact that patients with Crohn's disease react favorably towards treatment with bacteria producing recombinant IL-10. IL-10 inhibits the synthesis of a number of cytokines, including IFN-gamma, IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper T-cells. It also displays a potent ability to suppress the antigen-presentation capacity of antigen presenting cells. However, it is also stimulatory towards certain T cells and mast cells and stimulates B cell maturation and antibody production.

  • Arimoto T, et al. (2007) Interleukin-10 protects against inflammation-mediated degeneration of dopaminergic neurons in substantia nigra. Neurobiol Aging. 28(6):894-906.
  • Han X, et al. (2010) Effect of cobalt protoporphyrin on hyperexpression of heme oxygenase-1 and secretion of IL-10 in rat bone marrow mesenchymal stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 18(5):1297-301.
  • Cui QQ, et al. (2011) Expression of RhoA in the lung tissue of acute lung injury rats and the influence of RhoA on the expression of IL-8 and IL-10. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 77(7): 1436-41.
  • Images
      Recently Viewed Items