Quick Order

Rat SUMO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SUMO1cDNA Clone Product Information
cDNA Size:306
cDNA Description:ORF Clone of Rattus norvegicus SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) DNA.
Gene Synonym:Sumo1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.