After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human IL10Rb ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL10RB cDNA Clone Product Information
NCBI RefSeq:NM_000628.3
RefSeq ORF Size:978bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 10 receptor, beta with Flag tag.
Gene Synonym:CRFB4, CRF2-4, D21S58, D21S66, CDW210B, IL-10R2
Restriction Site:HindIII + XhoI (5.4kb + 1.03kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL10RB Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human IL10Rb natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.


Interleukin 10 receptor, beta subunit (IL10RB/IL-10RB) also known as Cytokine receptor family 2 member 4, Interleukin-10 receptor subunit 2, and cytokine receptor family II, member 4, is a subunit for the interleukin-10 receptor. IL10RB/IL-10RB belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. Defects in IL10RB/IL-10RB are the cause of inflammatory bowel disease type 25 (IBD25). It is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints.

  • Josephson K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15 (1): 35-46.
  • Yoo KH, et al. (2011) Association of IL10, IL10RA, and IL10RB polymorphisms with benign prostate hyperplasia in Korean population. J Korean Med Sci. 26(5): 659-64.
  • Size / Price
    Catalog: HG10945-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.