After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human HRG / HPRG ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HRG cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Histidine-rich glycoprotein, also known as HRG and HPRG, is a glycoprotein located in plasma and platelets, and contains an unusually large amount of histidine and proline. In human, five distinct domains are recognized in the mature HPRG molecule. There are two N-terminal cystatin-like modules (aa 19 - 254) and one His-Pro-rich region (aa 350 - 497) that is flanked by two Pro-rich segments (aa 276 - 321 and 498 - 525). The His-Pro-rich region contains 10 tandem repeats with an HHPHG motif, and the N- and C-termini are linked by a disulfide bond. The specific functions of HRG remain unclear, but it is known that the protein binds heme, dyes and divalent metal ions. It inhibits rosette formation and interacts with heparin, thrombospondin and plasminogen. Two of the protein's effects, the inhibition of fibrinolysis and the reduction of inhibition of coagulation, indicate a potential prothrombotic effect. HPRG is evolutionarily, functionally and structurally related to cleaved high molecular weight kininogen (HKa), an anti-angiogenic polypeptide that stimulates apoptosis of proliferating endothelial cells through binding to cell-surface tropomyosin. The antiangiogenic activity of the multidomain plasma protein HPRG is localized to its histidine-proline-rich (H/P) domain and has recently been shown to be mediated, at least partially, through binding to cell-surface tropomyosin in fibroblast growth factor-2-activated endothelial cells.

  • Guan X, et al. (2004) Histidine-proline rich glycoprotein (HPRG) binds and transduces anti-angiogenic signals through cell surface tropomyosin on endothelial cells. Thromb Haemost. 92(2): 403-12.
  • Doate F, et al. (2004) Peptides derived from the histidine-proline domain of the histidine-proline-rich glycoprotein bind to tropomyosin and have antiangiogenic and antitumor activities. Cancer Res. 64(16): 5812-7.