Quick Order

Human CD5L ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD5L cDNA Clone Product Information
Gene_bank_ref_id:NM_005894.2
RefSeq ORF Size:1044bp
cDNA Description:Full length Clone DNA of Homo sapiens CD5 molecule-like with Flag tag.
Gene Synonym:AIM, API6, PRO229, Spalpha, SP-ALPHA
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-CD5L-flag
Restriction Site:HindIII + XhoI (5.4kb + 1.09kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 825 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor cysteine-rich (SRCR) superfamily and contains three SRCR domains. It is a secreted glycoprotein and expressed by macrophages presentin lymphoid tissues (spleen, lymph node, thymus, and bone marrow). It binds to myelomonocytic and lymphoid cells and may play an important role in the regulation of the innate and adaptive immune systems. CD5L functions as a pattern recognition molecule by binding both lipoteichoic acid (LTA) on Gram positive and lipopolysaccharide (LPS) on Gram negative bacteria. and the SRCR domain 1 of CD5L retains both the LPS and LTA binding activities. In addtion, it is revealed that CD5L seems to play a role as an inhibitor of apoptosis.

References
  • Resnick, D. et al., 1994, Trends Biochem. Sci. 19: 5-8.
  • Gebe, J. A. et al., 1997, J. Biol. Chem. 272 (10): 6151–6158.
  • Sarrias, M.R. et al., 2004, Crit. Rev. Immunol. 24: 1-37.
  • Mukhopadhyay, S. and Gordon, S., 2004, Immunobiology 209: 39-49.
  • Sarrias, M. R. et al.,2005, J. Biol. Chem. 280 (42): 35391–35398.
  • Size / Price
    Catalog: HG10791-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"