After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse BTK cDNA Clone Product Information
Gene_bank_ref_id:NM_013482.2
RefSeq ORF Size:1980bp
cDNA Description:Full length Clone DNA of Mus musculus Bruton agammaglobulinemia tyrosine kinase with C terminal His tag.
Gene Synonym:xid, AI528679, Btk
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mouse Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-His tag on other vectors
Product nameProduct name
Background

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

References
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    Catalog: MG50607-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"