Quick Order

Human BLK Kinase Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BLKcDNA Clone Product Information
cDNA Size:1518
cDNA Description:ORF Clone of Homo sapiens B lymphoid tyrosine kinase DNA.
Gene Synonym:MGC10442
Restriction Site:HindIII + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 843 T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human BLK Kinase Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged on other vectors
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10782-ACG$345
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10782-ACR$345
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10782-ANG$345
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10782-ANR$345
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10782-CF$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10782-CH$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10782-CM$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10782-CY$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone)HG10782-M$115
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10782-M-F$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10782-M-N$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10782-NF$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10782-NH$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10782-NM$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10782-NY$315
Human BLK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10782-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Tyrosine-protein kinase Blk, also known as B lymphocyte kinase, p55-Blk and BLK, is a member of the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. BLK / p55-Blk is expressed in lymphatic organs, pancreatic islets, Leydig cells, striate ducts of salivary glands and hair follicles. BLK / p55-Blk is a src-family protein tyrosine kinase specifically expressed in B-lineage cells of mice. The early onset of Blk expression during B-cell development in the bone marrow and the high expression levels of Blk in mature B cells suggest a possible important role of Blk in B-cell physiology. It is a modulator of beta-cells function, acting through the up-regulation of PDX1 and NKX6-1 and consequent stimulation of insulin secretion in response to glucose. Defects in BLK are a cause of maturity-onset diabetes of the young type 11 which is a form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease.

  • Dymecki,S.M. et al., 1992, J Biol Chem. 267 (7):4815-23.
  • Drebin J.A. et al., 1995, Oncogene 10:477-86.
  • Islam K.B.et al., 1995, J. Immunol. 154:1265-72.
  • Texido,G. et al., 2000, Mol Cell Biol. 20 (4):1227-33.
  • Borowiec M. et al., 2009, Proc. Natl. Acad. Sci. USA. 106: 14460-5.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
      Recently Viewed Items